Pay in 4 interest-free payments of $5.57 Learn more
Ships within 48 hours · Estimated delivery Aug 28 - Sep 2
The following shRNA constructs were used (See also Key Resources Table): shGFP, shFOXO4-1: TRCN0000039720, Mature sequence: CCAGCTTCAGTCAGCAGTTAT, shFOXO4-2: TRCN0000039721, Mature sequence: CGTCCACGAAGCAGTTCAAAT, shFOXO4(mouse): TRCN0000071560, Mature sequence: GATCTGGATCTTGATATGTAT, shp53-1: TRCN0000003753, Mature sequence: CGGCGCACAGAGGAAGAGAAT and shp53-2: TRCN0000003754, Mature sequence: TCAGACCTATGGAAACTACTT
10.1111/1523-1747.ep12294284
PINK1-dependent phosphorylation of Serine111 within the SF3 motif of Rab GTPases impairs effector interactions and LRRK2-mediated phosphorylation at Threonine72
We deliver the same level of professionalism you would expect from a hospital or urgent care facility, ensuring that your IV treatment meets the highest safety standards
US$ 22.42
US$ 27.82
US$ 27.08
US$ 29.27
US$ 28.89
US$ 26.18
US$ 22.96
US$ 22.48
US$ 25.95
US$ 28.42
US$ 24.57